After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RELT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001108495.1
Размер кДНК:1284bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus RELT tumor necrosis factor receptor with N terminal Flag tag.
Синоним гена:Tnfrsf19l, Relt
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80168-ACGRBS15400
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80168-ACRRBS15400
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80168-CFRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80168-CHRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80168-CMRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80168-CYRBS13340
Крыса RELT/TNFRSF19L Джин клон кДНК в вектор клонированияRG80168-GRBS5130
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80168-NFRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80168-NHRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80168-NMRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80168-NYRBS13340
Крыса RELT/TNFRSF19L Джин ORF экспрессии кДНК клона плазмидыRG80168-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX40, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.

Ссылки
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
  • Size / Price
    Каталог: RG80168-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».