After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat REG4 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001004096.1
Размер кДНК:474bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus regenerating islet-derived family, member 4.
Синоним гена:Reg4
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80249-ACGRBS15400
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80249-ACRRBS15400
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80249-CFRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80249-CHRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80249-CMRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80249-CYRBS13340
Крыса REG4 Джин клон кДНК в вектор клонированияRG80249-GRBS5130
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80249-NFRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80249-NHRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80249-NMRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80249-NYRBS13340
Крыса REG4 Джин ORF экспрессии кДНК клона плазмидыRG80249-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

Ссылки
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».