After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat REG3A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001145846.2
Размер кДНК:525bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus regenerating islet-derived 3 alpha.
Синоним гена:Pap2, PapII, Reg3a
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80258-ACGRBS15400
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80258-ACRRBS15400
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80258-CFRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80258-CHRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80258-CMRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80258-CYRBS13340
Крыса REG3A Джин клон кДНК в вектор клонированияRG80258-GRBS5130
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80258-NFRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80258-NHRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80258-NMRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80258-NYRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмидыRG80258-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

Ссылки
  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • Size / Price
    Каталог: RG80258-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».