Быстрый заказ

Text Size:AAA

Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat REG3A Информация о продукте «Клон cDNA»
Размер кДНК:525bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus regenerating islet-derived 3 alpha with C terminal His tag.
Синоним гена:Pap2, PapII, Reg3a
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80258-ACGRBS15400
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80258-ACRRBS15400
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80258-CFRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80258-CHRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80258-CMRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80258-CYRBS13340
Крыса REG3A Джин клон кДНК в вектор клонированияRG80258-GRBS5130
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80258-NFRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80258-NHRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80258-NMRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80258-NYRBS13340
Крыса REG3A Джин ORF экспрессии кДНК клона плазмидыRG80258-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Regenerating islet-derived protein 3-alpha, also known as Regenerating islet-derived protein III-alpha, REG-3-alpha, REG3A, and HIP, is secreted protein which contains one C-type lectin domain. REG3A is constitutively expressed in intestine, and is a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It is overexpressed during the acute phase of pancreatitis and in some patients with chronic pancreatitis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. REG3A is also a stress protein involved in the control of bacterial proliferation. REG3A is down-regulated in most primary human gastric cancer cells, and might be useful in the diagnosis of gastric cancer. Additionally, REG3A is a target of beta-catenin signaling in Huh7 hepatoma cells. The REG1A and REG3A are downstream targets of the Wnt pathway during liver tumorigenesis.

  • Cavard C, et al. (2006) Overexpression of regenerating islet-derived 1 alpha and 3 alpha genes in human primary liver tumors with beta-catenin mutations. Oncogene. 25(4): 599-608.
  • Choi B, et al. (2007) Downregulation of regenerating islet-derived 3 alpha (REG3A) in primary human gastric adenocarcinomas. Exp Mol Med. 39(6): 796-804.
  • Size / Price
    Каталог: RG80258-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.