Быстрый заказ

Text Size:AAA

Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat REG1A Информация о продукте «Клон cDNA»
Размер кДНК:498bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus regenerating islet-derived 1 alpha with C terminal His tag.
Синоним гена:Reg, RGPI, Reg1, Rgp1, LITHOST, RATRGPI, RATLITHOST, Reg1a
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80300-ACGRBS15400
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80300-ACRRBS15400
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80300-CFRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80300-CHRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80300-CMRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80300-CYRBS13340
Крыса REG1A Джин клон кДНК в вектор клонированияRG80300-GRBS5130
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80300-NFRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80300-NHRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80300-NMRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80300-NYRBS13340
Крыса REG1A Джин ORF экспрессии кДНК клона плазмидыRG80300-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Regenerating (reg) gene encodes protein that has been involved in pancreatic lithogenesis and the regeneration of islet cells and therefore the abnormality of reg genes could be associated with fibrocalculous pancreatopathy. REG I has been shown to be crucial for induction of ductal epithelial cells to differentiate into some cells. Lithostathine-1-alpha, also known as Pancreatic stone protein, Pancreatic thread protein, Regenerating islet-derived protein 1-alpha, REG1A, REG-1-alpha, and PSPS, is highly expressed in fetal and infant brains. REG1A contains one C-type lectin domain and is a known growth factor affecting pancreatic islet beta cells. REG1A may act as an inhibitor of spontaneous calcium carbonate precipitation. It may also be associated with neuronal sprouting in brain, and with brain and pancreas regeneration. REG1A has been reported to be expressed in human cancers, and it may be positively correlated with patient's prognosis. REG3A and REG1A proteins are both involved in liver and pancreatic regeneration and proliferation. High levels of REG1A expression by tumor cells are an independent predictor of a poor prognosis in patients with non-small cell lung cancer (NSCLC).

  • Boonyasrisawat W, et al. (2002) Analysis of the reg1alpha and reg1beta gene transcripts in patients with fibrocalculous pancreatopathy. Southeast Asian J Trop Med Public Health. 33(2): 365-72.
  • Tezel E, et al. (2004) REG I as a marker for human pancreatic acinoductular cells. Hepatogastroenterology. 51(55): 91-6.
  • Geng J, et al. (2009) REG1A predicts recurrence in stage Ta/T1 bladder cancer. Eur J Surg Oncol. 35(8): 852-7.
  • Size / Price
    Каталог: RG80300-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.