Быстрый заказ

Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RBM5 Информация о продукте «Клон cDNA»
Размер кДНК:2448bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus RNA binding motif protein 5 with C terminal His tag.
Синоним гена:Rbm5
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81059-ACGRBS16760
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81059-ACRRBS16760
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81059-ANGRBS16760
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81059-ANRRBS16760
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81059-CFRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81059-CHRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81059-CMRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81059-CYRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81059-NFRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81059-NHRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81059-NMRBS14710
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81059-NYRBS14710
Крыса RBM5 Джин клон кДНК в вектор клонированияRG81059-URBS5130
Крыса RBM5 Джин ORF экспрессии кДНК клона плазмидыRG81059-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.