After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RBM47 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001005882.1
Размер кДНК:1773bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus RNA binding motif protein 47.
Синоним гена:RGD1359713
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81057-ACGRBS16760
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81057-ACRRBS16760
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81057-ANGRBS16760
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81057-ANRRBS16760
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81057-CFRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81057-CHRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81057-CMRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81057-CYRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81057-NFRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81057-NHRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81057-NMRBS14710
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81057-NYRBS14710
Крыса RBM47 Джин клон кДНК в вектор клонированияRG81057-URBS5130
Крыса RBM47 Джин ORF экспрессии кДНК клона плазмидыRG81057-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81057-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».