After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat RBM41 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001109420.1
Размер кДНК:1242bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus RNA binding motif protein 41.
Синоним гена:Rbm41
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81032-ACGRBS15400
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81032-ACRRBS15400
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81032-ANGRBS15400
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81032-ANRRBS15400
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81032-CFRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81032-CHRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81032-CMRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81032-CYRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81032-NFRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81032-NHRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81032-NMRBS13340
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81032-NYRBS13340
Крыса RBM41 Джин клон кДНК в вектор клонированияRG81032-URBS5130
Крыса RBM41 Джин ORF экспрессии кДНК клона плазмидыRG81032-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81032-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».