Быстрый заказ

Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса RAB1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031090.2
Размер кДНК:618bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus RAB1A, member RAS oncogene family with C terminal His tag.
Синоним гена:Rab1, Rab1r, Ac2-048
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81648-ACGRBS15400
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81648-ACRRBS15400
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81648-CFRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81648-CHRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81648-CMRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81648-CYRBS13340
Крыса RAB1A Джин клон кДНК в вектор клонированияRG81648-GRBS5130
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81648-NFRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81648-NHRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81648-NMRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81648-NYRBS13340
Крыса RAB1A Джин ORF экспрессии кДНК клона плазмидыRG81648-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81648-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».