After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PVRL2 Информация о продукте «Клон cDNA»
Размер кДНК:1593bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus poliovirus receptor-related 2 with C terminal His tag.
Синоним гена:MGC94554, Pvrl2
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80327-ACGRBS16760
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80327-ACRRBS16760
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80327-CFRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80327-CHRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80327-CMRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80327-CYRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин клон кДНК в вектор клонированияRG80327-GRBS5130
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80327-NFRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80327-NHRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80327-NMRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80327-NYRBS14710
Крыса CD112/Nectin-2/PVRL2 Джин ORF экспрессии кДНК клона плазмидыRG80327-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Cluster of Differentiation 112 (CD112), also known as poliovirus receptor related protein 2 (PVRL2 or PRR2), is a single-pass type I transmembrane glycoprotein belonging to the Immunoglobulin superfamily. CD112 protein also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and thus is involved in cell to cell spreading of these viruses. CD112 protein has been identified as the ligand for DNAM-1 (CD226), and the interaction of CD226/CD112 protein can induce NK cell- and CD8+ T cell-mediated cytotoxicity and cytokine secretion. CD112 has been regarded as a critical component in allergic reactions, and accordingly may function as a novel target for anti-allergic therapy.

  • Bachelet I, et al. (2006) Mast cell costimulation by CD226/CD112 (DNAM-1/Nectin-2): a novel interface in the allergic process. J Biol Chem. 281(37): 27190-6.
  • Wang L, et al. (2009) Molecular cloning, characterization and three-dimensional modeling of porcine nectin-2/CD112. Vet Immunol Immunopathol. 132(2-4): 257-63.
  • Size / Price
    Каталог: RG80327-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.