After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PVRL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:XM_236210.5
Размер кДНК:1548bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus poliovirus receptor-related 1.
Синоним гена:HveC, nectin-1, Pvrl1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80244-ACGRBS16760
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80244-ACRRBS16760
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80244-CFRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80244-CHRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80244-CMRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80244-CYRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин клон кДНК в вектор клонированияRG80244-GRBS5130
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80244-NFRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80244-NHRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80244-NMRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80244-NYRBS14710
Крыса CD111/Nectin-1/PVRL1 Джин ORF экспрессии кДНК клона плазмидыRG80244-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin-1; CD111), also known as PVRL1 is a cell adhesion molecule belonging to the immunoglobulin superfamily that can bind to virion glycoprotein D (gD) to mediate entry of herpes simplex viruses (HSV) and pseudorabies virus (PRV). CD111/Nectin-1/PVRL1 colocalizes with E-cadherin at adherens junctions in epithelial cells. The disruption of cell junctions can result in the redistribution of nectin-1. To determine whether disruption of junctions by calcium depletion influenced the susceptibility of epithelial cells to viral entry, Madin-Darby canine kidney cells expressing endogenous nectin-1 or transfected human nectin-1 were tested for the ability to bind soluble forms of viral gD and to be infected by HSV and PRV, before and after calcium depletion. It has been revealed that binding of HSV and PRV gD was localized to adherens junctions in cells maintained in normal medium but was distributed, along with nectin-1, over the entire cell surface after calcium depletion. Both the binding of gD and the fraction of cells that could be infected by HSV-1 and PRV were enhanced by calcium depletion. Taken together, CD111/Nectin-1/PVRL1 confined to adherens junctions in epithelial cells is not very accessible to virus, whereas dissociation of cell junctions releases nectin-1 to serve more efficiently as an entry recptor.

Ссылки
  • Yoon M, et al. (2002) Disruption of adherens junctions liberates nectin-1 to serve as receptor for herpes simplex virus and pseudorabies virus entry. J Virol. 76(14): 7203-8.
  • Mata M, et al. (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7(5): 476-80.
  • Haarr L, et al. (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology. 287(2): 301-9.
  • Size / Price
    Каталог: RG80244-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».