Быстрый заказ

Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PTN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_017066.2
Размер кДНК:507bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus pleiotrophin with C terminal Flag tag.
Синоним гена:Hbnf
Виды:Rat
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81121-ACGRBS15400
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81121-ACRRBS15400
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81121-CFRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81121-CHRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81121-CMRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81121-CYRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81121-NFRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81121-NHRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81121-NMRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81121-NYRBS13340
Крыса Pleiotrophin / PTN / HB-GAM Джин клон кДНК в вектор клонированияRG81121-URBS5130
Крыса Pleiotrophin / PTN / HB-GAM Джин ORF экспрессии кДНК клона плазмидыRG81121-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

HB-GAM belongs to the pleiotrophin family. During embryonic and early postnatal development, HB-GAM is expressed in the central and peripheral nervous system and also in several non-neural tissues, notably lung, kidney, gut and bone. While in the adult central nervous system, it is expressed in an activity-dependent manner in the hippocampus where it can suppress long term potentiation induction. HB-GAM has a low expression in other areas of the adult brain, but it can be induced by ischemic insults, or targeted neuronal damaged in the entorhinal cortex or in the substantia nigra pars compacta. It is structurally related to midkine and retinoic acid induced heparin-binding protein and has a high affinity for heparin. HB-GAM binds anaplastic lymphoma kinase (ALK) which induces MAPK pathway activation, an important step in the anti-apoptotic signaling of PTN and regulation of cell proliferation. It also functions as a secreted growth factor and induces neurite outgrowth and which is mitogenic for fibroblasts, epithelial, and endothelial cells.

Ссылки
  • Vanderwinden JM, et al. (1992) Cellular distribution of the new growth factor pleiotrophin (HB-GAM) mRNA in developing and adult rat tissues. Anat Embryol. 186(4):387-406.
  • Lauri SE, et al. (1996) Activity-induced enhancement of HB-GAM expression in rat hippocampal slices. Neuroreport. 7(10):1670-4.
  • Pavlov I, et al. (2002) Role of heparin-binding growth-associated molecule (HB-GAM) in hippocampal LTP and spatial learning revealed by studies on overexpressing and knockout mice. Mol Cell Neurosci. 20(2):330-42.
  • Size / Price
    Каталог: RG81121-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».