Быстрый заказ

Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PTGDS Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus prostaglandin D2 synthase (brain) with N terminal Flag tag.
Синоним гена:PH2DISO
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81340-ACGRBS15400
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81340-ACRRBS15400
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81340-CFRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81340-CHRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81340-CMRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81340-CYRBS13340
Крыса PTGDS / L-PGDS Джин клон кДНК в вектор клонированияRG81340-GRBS5130
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81340-NFRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81340-NHRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81340-NMRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81340-NYRBS13340
Крыса PTGDS / L-PGDS Джин ORF экспрессии кДНК клона плазмидыRG81340-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

PTGDS, also known as L-PGDS, belongs to the calycin superfamily,lipocalin family. Lipocalins share limited regions of sequence homology and a common tertiary structure architecture. They transport small hydrophobic molecules such as steroids, bilins, retinoids, and lipids. PTGDS is a glutathione-independent prostaglandin D synthase that catalyzes the conversion of PGH2 to PGD2. It is involved in smooth muscle contraction/relaxation and a variety of central nervous system functions. PTGDS may have an anti-apoptotic role in oligodendrocytes. It binds small non-substrate lipophilic molecules, including biliverdin, bilirubin, retinal, retinoic acid and thyroid hormone, and may act as a scavenger for harmful hydrophopic molecules and as a secretory retinoid and thyroid hormone transporter. It is likely to play important roles in both maturation and maintenance of the central nervous system and male reproductive system.

  • Aebersold R, et al. (1993) Identification of a brain-specific human cerebrospinal fluid glycoprotein, beta-trace protein. Theor Electrophor. 3:229-234.
  • Oliver K, et al. (2004) DNA sequence and analysis of human chromosome 9. Nature. 429:369-374.
  • Bonaldo MF, et al. (1997) Normalization and subtraction: two approaches to facilitate gene discovery. Genome Res. 6(9):791-806.
  • Size / Price
    Каталог: RG81340-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.