Быстрый заказ

Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса PTBP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_022516.5
    Размер кДНК:1593bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus polypyrimidine tract binding protein 1.
    Синоним гена:Ptb, Pybp, Pybp1, Pybp2
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PTBP1 qPCR primers for gene expression analysis, RP301010 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81046-ACGRBS16760
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81046-ACRRBS16760
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81046-ANGRBS16760
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81046-ANRRBS16760
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81046-CFRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81046-CHRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81046-CMRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81046-CYRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81046-NFRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81046-NHRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81046-NMRBS14710
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81046-NYRBS14710
    Крыса PTBP1 Джин клон кДНК в вектор клонированияRG81046-URBS5130
    Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмидыRG81046-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81046-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».