After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PTBP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022516.5
Размер кДНК:1593bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus polypyrimidine tract binding protein 1.
Синоним гена:Ptb, Pybp, Pybp1, Pybp2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81046-ACGRBS16760
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81046-ACRRBS16760
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81046-ANGRBS16760
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81046-ANRRBS16760
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81046-CFRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81046-CHRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81046-CMRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81046-CYRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81046-NFRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81046-NHRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81046-NMRBS14710
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81046-NYRBS14710
Крыса PTBP1 Джин клон кДНК в вектор клонированияRG81046-URBS5130
Крыса PTBP1 Джин ORF экспрессии кДНК клона плазмидыRG81046-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81046-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».