Быстрый заказ

Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса PSMC3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC062019.1
    Размер кДНК:1329bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus proteasome (prosome, macropain) 26S subunit, ATPase 3.
    Синоним гена:Psmc3
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PSMC3 qPCR primers for gene expression analysis, RP300968 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81004-ACGRBS15400
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81004-ACRRBS15400
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81004-ANGRBS15400
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81004-ANRRBS15400
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81004-CFRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81004-CHRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81004-CMRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81004-CYRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81004-NFRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81004-NHRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81004-NMRBS13340
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81004-NYRBS13340
    Крыса PSMC3 Джин клон кДНК в вектор клонированияRG81004-URBS5130
    Крыса PSMC3 Джин ORF экспрессии кДНК клона плазмидыRG81004-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81004-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».