Быстрый заказ

Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса PROM1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001110137.1
    Размер кДНК:2481bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus prominin 1 with N terminal His tag.
    Синоним гена:Prom, CD133, MGC156650, Prom1
    Виды:Rat
    переносчик:pCMV3-SP-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PROM1 qPCR primers for gene expression analysis, RP300295 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80324-ACGRBS16760
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80324-ACRRBS16760
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80324-CFRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80324-CHRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80324-CMRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80324-CYRBS14710
    Крыса PROM1 Джин клон кДНК в вектор клонированияRG80324-GRBS5130
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80324-NFRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80324-NHRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80324-NMRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80324-NYRBS14710
    Крыса PROM1 Джин ORF экспрессии кДНК клона плазмидыRG80324-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

    Ссылки
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    Каталог: RG80324-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».