After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PROM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001110137.1
Размер кДНК:2481bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus prominin 1 with C terminal HA tag.
Синоним гена:Prom, CD133, MGC156650, Prom1
Виды:Rat
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80324-ACGRBS16760
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80324-ACRRBS16760
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80324-CFRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80324-CHRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80324-CMRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80324-CYRBS14710
Крыса PROM1 Джин клон кДНК в вектор клонированияRG80324-GRBS5130
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80324-NFRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80324-NHRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80324-NMRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80324-NYRBS14710
Крыса PROM1 Джин ORF экспрессии кДНК клона плазмидыRG80324-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

CD133, also known as PROM1 and Prominin 1, is a pentaspan transmembrane glycoprotein which belongs to the prominin family. It localizes to membrane protrusions and is often expressed on adult stem cells. CD133 is known to play a role in maintaining stem cell properties by suppressing differentiation. CD133 binds cholesterol in cholesterol-containing plasma membrane microdomains. It is proposed to play a role in apical plasma membrane organization of epithelial cells. CD133 is also involved in regulation of MAPK and Akt signaling pathways. Mutations in PROM1 gene have been shown to result in retinitis pigmentosa and Stargardt disease. PROM1 gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Expression of this gene is also associated with several types of cancer.

Ссылки
  • Corbeil D. et al., 2001, Biochem Biophys Res Commun. 285 (4): 939-44.
  • Horn PA. et al., 1999, Blood. 93 (4): 1435-37.
  • Sanai N. et al., 2005, N Engl J Med. 353 (8): 811-22.
  • Size / Price
    Каталог: RG80324-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».