Быстрый заказ

Text Size:AAA

Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PRL8A9 Информация о продукте «Клон cDNA»
Размер кДНК:726bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus prolactin family 8, subfamily a, member 9 with N terminal Myc tag.
Синоним гена:Prl8a9
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80699-ACGRBS15400
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80699-ACRRBS15400
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80699-CFRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80699-CHRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80699-CMRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80699-CYRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80699-NFRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80699-NHRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80699-NMRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80699-NYRBS13340
Крыса Prolactin-8A9 / PLP-C beta Джин клон кДНК в вектор клонированияRG80699-URBS5130
Крыса Prolactin-8A9 / PLP-C beta Джин ORF экспрессии кДНК клона плазмидыRG80699-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.