After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PPP2R1A Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_057140.1
Размер кДНК:1770bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus protein phosphatase 2, regulatory subunit A, alpha.
Синоним гена:PR65
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81015-ACGRBS16764
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81015-ACRRBS16764
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81015-ANGRBS16764
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81015-ANRRBS16764
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81015-CFRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81015-CHRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81015-CMRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81015-CYRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81015-NFRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81015-NHRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81015-NMRBS14711
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81015-NYRBS14711
Крыса PPP2R1A Джин клон кДНК в вектор клонированияRG81015-URBS5132
Крыса PPP2R1A Джин ORF экспрессии кДНК клона плазмидыRG81015-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81015-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».