Быстрый заказ

Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса PLEKHB2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001106899.1
    Размер кДНК:666bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus pleckstrin homology domain containing, family B (evectins) member 2.
    Синоним гена:Plekhb2
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PLEKHB2 qPCR primers for gene expression analysis, RP300976 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81012-ACGRBS15400
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81012-ACRRBS15400
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81012-ANGRBS15400
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81012-ANRRBS15400
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81012-CFRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81012-CHRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81012-CMRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81012-CYRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81012-NFRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81012-NHRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81012-NMRBS13340
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81012-NYRBS13340
    Крыса PLEKHB2 Джин клон кДНК в вектор клонированияRG81012-URBS5130
    Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмидыRG81012-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81012-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».