After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PLEKHB2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106899.1
Размер кДНК:666bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus pleckstrin homology domain containing, family B (evectins) member 2.
Синоним гена:Plekhb2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81012-ACGRBS15400
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81012-ACRRBS15400
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81012-ANGRBS15400
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81012-ANRRBS15400
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81012-CFRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81012-CHRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81012-CMRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81012-CYRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81012-NFRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81012-NHRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81012-NMRBS13340
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81012-NYRBS13340
Крыса PLEKHB2 Джин клон кДНК в вектор клонированияRG81012-URBS5130
Крыса PLEKHB2 Джин ORF экспрессии кДНК клона плазмидыRG81012-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81012-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».