After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PLAU Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_013085.3
Размер кДНК:1299bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus plasminogen activator, urokinase with N terminal Flag tag.
Синоним гена:UPAM
Виды:Rat
переносчик:pCMV3-SP-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81600-ACGRBS15400
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81600-ACRRBS15400
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81600-CFRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81600-CHRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81600-CMRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81600-CYRBS13340
Крыса Urokinase/PLAU Джин клон кДНК в вектор клонированияRG81600-GRBS5130
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81600-NFRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81600-NHRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81600-NMRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81600-NYRBS13340
Крыса Urokinase/PLAU Джин ORF экспрессии кДНК клона плазмидыRG81600-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Plasminogen activator, urokinase, also known as PLAU and uPA, is a serine protease which converts plasminogen to plasmin, a broad-spectrum protease active on extracellular matrix (ECM) components. It is involved in complement activation, cell migration, wound healing, and generation of localized extracellular proteolysis during tissue remodelling, pro-hormone conversion, carcinogenesis and neoplasia. Like many components of the blood coagulation, fibrinolytic and complement cascades, uPA has a modular structure, including three conserved domains: a growth factor-like domain (GFD, residues 1-49), a kringle domain (residues 50-131), linked by an interdomain linker or "connecting peptide" (CP, residues 132-158) to the serine protease domain (residues 159-411). uPA and its receptor (uPAR) have been implicated in a broad spectrum of pathophysiological processes, including fibrinolysis, proteolysis, inflammation, atherogenesis and plaque destabilization, all of which are involved in the pathogenesis of MI (myocardial infarction). The role of uPA is not only linked to its action as an enzyme. In fact, the mere binding of uPA on the cell surface also brings about two events that broaden the spectrum of its biological functions: (1) a conformational change of the receptor, which, in turn, affects its interaction with other proteins; (2) a signal transduction which modulates the expression of apoptosis-related genes. Besides its applications as a thrombolytic agent and as a prognostic marker for tumors, uPA may provide the basis for other therapies, as the structure of the receptor-binding domain of uPA has become a model for the design of anti-cancer molecules. Because of the causal involvment of uPA in cancer invasion and metastasis, the blockade of uPA interactions and activity with specific inhibitors is of interest for novel strategies in cancer therapy.

Ссылки
  • Crippa MP. (2007) Urokinase-type plasminogen activator. Int J Biochem Cell Biol. 39(4): 690-4.
  • Kunamneni A, et al. (2008) Urokinase-a very popular cardiovascular agent. Recent Pat Cardiovasc Drug Discov. 3(1): 45-58.
  • Vincenza Carriero M, et al. (2009) Structure, function and antagonists of urokinase-type plasminogen activator. Front Biosci. 14: 3782-94.
  • Xu J, et al. (2010) Association of putative functional variants in the PLAU gene and the PLAUR gene with myocardial infarction. Clin Sci (Lond). 119(8): 353-9.
  • Size / Price
    Каталог: RG81600-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».