Быстрый заказ

Text Size:AAA

Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PITPNB Информация о продукте «Клон cDNA»
Размер кДНК:816bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus phosphatidylinositol transfer protein, beta with C terminal His tag.
Синоним гена:Pitpnb
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81035-ACGRBS15400
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81035-ACRRBS15400
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81035-ANGRBS15400
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81035-ANRRBS15400
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81035-CFRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81035-CHRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81035-CMRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81035-CYRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81035-NFRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81035-NHRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81035-NMRBS13340
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81035-NYRBS13340
Крыса PITPNB Джин клон кДНК в вектор клонированияRG81035-URBS5130
Крыса PITPNB Джин ORF экспрессии кДНК клона плазмидыRG81035-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81035-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.