After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PIGQ Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001007607.1
Размер кДНК:1746bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus phosphatidylinositol glycan anchor biosynthesis, class Q with N terminal Myc tag.
Синоним гена:Pigq
Виды:Rat
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81651-ACGRBS16764
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81651-ACRRBS16764
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81651-CFRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81651-CHRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81651-CMRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81651-CYRBS14711
Крыса PIGQ Джин клон кДНК в вектор клонированияRG81651-GRBS5132
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81651-NFRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81651-NHRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81651-NMRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81651-NYRBS14711
Крыса PIGQ Джин ORF экспрессии кДНК клона плазмидыRG81651-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81651-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».