After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PEAR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001134959.1
Размер кДНК:3102bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus platelet endothelial aggregation receptor 1.
Синоним гена:MGC188434, RGD1305653, Pear1
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80245-ACGRBS22240
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80245-ACRRBS22240
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80245-CFRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80245-CHRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80245-CMRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80245-CYRBS20190
Крыса PEAR1/MEGF12 Джин клон кДНК в вектор клонированияRG80245-GRBS5130
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80245-NFRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80245-NHRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80245-NMRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80245-NYRBS20190
Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмидыRG80245-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».