Быстрый заказ

Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса PEAR1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001134959.1
    Размер кДНК:3102bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus platelet endothelial aggregation receptor 1.
    Синоним гена:MGC188434, RGD1305653, Pear1
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PEAR1 qPCR primers for gene expression analysis, RP300231 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80245-ACGRBS22240
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80245-ACRRBS22240
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80245-CFRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80245-CHRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80245-CMRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80245-CYRBS20190
    Крыса PEAR1/MEGF12 Джин клон кДНК в вектор клонированияRG80245-GRBS5130
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80245-NFRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80245-NHRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80245-NMRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80245-NYRBS20190
    Крыса PEAR1/MEGF12 Джин ORF экспрессии кДНК клона плазмидыRG80245-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80245-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».