Быстрый заказ

Text Size:AAA

Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PDIA4 Информация о продукте «Клон cDNA»
Размер кДНК:1932bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus protein disulfide isomerase family A, member 4 with C terminal His tag.
Синоним гена:Erp70, Erp72, ERp-72
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81061-ACGRBS16760
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81061-ACRRBS16760
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81061-CFRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81061-CHRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81061-CMRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81061-CYRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81061-NFRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81061-NHRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81061-NMRBS14710
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81061-NYRBS14710
Крыса ERP72 / PDIA4 Джин клон кДНК в вектор клонированияRG81061-URBS5130
Крыса ERP72 / PDIA4 Джин ORF экспрессии кДНК клона плазмидыRG81061-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.

  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Size / Price
    Каталог: RG81061-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.