After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PDCD1LG2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001107582.2
Размер кДНК:807bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus programmedcelldeath1ligand2 with N terminal HA tag.
Синоним гена:Pdcd1lg2
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80454-ACGRBS15400
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80454-ACRRBS15400
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80454-CFRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80454-CHRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80454-CMRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80454-CYRBS13340
Крыса PD-L2/B7-DC/CD273 Джин клон кДНК в вектор клонированияRG80454-GRBS5130
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80454-NFRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80454-NHRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80454-NMRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80454-NYRBS13340
Крыса PD-L2/B7-DC/CD273 Джин ORF экспрессии кДНК клона плазмидыRG80454-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Programmed death ligand 2 (PD-L2), also referred to as B7-DC and CD273, is a member of the B7 family of proteins including B7-1, B7-2, B7-H2, B7-H1 (PD-L1), and B7-H3. PD-L2 is a type I membrane protein and structurally consists of an extracellular region containing one V-like and one C-like Ig domain, a transmembrane region, and a short cytoplasmic domain. PD-L2 is expressed on antigen presenting cells, placental endothelium and medullary thymic epithelial cells, and can be induced by LPS in B cells, INF-γ in monocytes, or LPS plus IFN-γ in dendritic cells. The CD28 and B7 protein families are critical regulators of immune responses. PD-L2 and PD-L1 are two ligands for PD-1, member of the CD28/CTLA4 family expressed on activated lymphoid cells, and thus provide signals for regulating T cell activation and immune tolerance. The interaction of B7-DC/PD-1 exhibited a 2-6-fold higher affinity compared with the interaction of B7-H1/PD-1.

Ссылки
  • Latchman Y, et al. (2001) PD-L2 is a second ligand for PD-1 and inhibits T cell activation. Nat Immunol. 2: 261-8.
  • Carreno BM, et al. (2005) Therapeutic opportunities in the B7/CD28 family of ligands and receptors. Curr Opin Pharmacol. 5(4): 424-30.
  • Radhakrishnan S, et al. (2007) B7-DC/PD-L2 cross-linking induces NF-kappaB-dependent protection of dendritic cells from cell death. J Immunol. 178(3): 1426-32.
  • Size / Price
    Каталог: RG80454-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».