After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PDCD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001106927.1
Размер кДНК:854bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus programmedcelldeath1 with N terminal HA tag.
Синоним гена:Pdcd1
Виды:Rat
переносчик:pCMV3-SP-N-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80448-ACGRBS15400
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80448-ACRRBS15400
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80448-CFRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80448-CHRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80448-CMRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80448-CYRBS13340
Крыса PD1/PDCD1/CD279 Джин клон кДНК в вектор клонированияRG80448-GRBS5130
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80448-NFRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80448-NHRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80448-NMRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80448-NYRBS13340
Крыса PD1/PDCD1/CD279 Джин ORF экспрессии кДНК клона плазмидыRG80448-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

Ссылки
  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».