Быстрый заказ

Text Size:AAA

Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat PARK7 Информация о продукте «Клон cDNA»
Размер кДНК:570bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus parkinson protein 7 with N terminal HA tag.
Синоним гена:Dj1, CAP1, DJ-1, SP22
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA Метка on other vectors
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80500-ACGRBS15396
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80500-ACRRBS15396
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG80500-ANGRBS15400
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG80500-ANRRBS15396
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80500-CFRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80500-CHRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80500-CMRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80500-CYRBS13340
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80500-NFRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80500-NHRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80500-NMRBS13343
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80500-NYRBS13340
Крыса PARK7/DJ-1 Джин клон кДНК в вектор клонированияRG80500-URBS5132
Крыса PARK7/DJ-1 Джин ORF экспрессии кДНК клона плазмидыRG80500-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Parkinson's disease locus DJ-1 (PARK7) is a differentially expressed transcript. DJ-1 plays a physiologic role in protection of erythroid cells from oxidant damage, a function unmasked in the context of oxidative stress. PARK7 belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Mutations in the DJ-1 gene are associated with rare forms of autosomal recessive early-onset Parkinson's disease (PD). DJ-1/p53 interactions contribute to apoptosis resistance in clonal myeloid cells and may serve as a prognostic marker in patients with myelodysplastic syndromes (MDS). DJ-1 regulates redox signaling kinase pathways and acts as a transcriptional regulator of antioxidative gene batteries. Therefore, DJ-1 is an important redox-reactive signaling intermediate controlling oxidative stress after ischemia, upon neuroinflammation, and during age-related neurodegenerative processes. Augmenting DJ-1 activity might provide novel approaches to treating chronic neurodegenerative illnesses such as Parkinson's disease and acute damage such as stroke.

  • Takahashi K, et al. (2001). DJ-1 positively regulates the androgen receptor by impairing the binding of PIASx alpha to the receptor. J. Biol. Chem. (United States). 276 (40): 37556-63.
  • Niki, Takeshi, et al. (2003). DJBP: a novel DJ-1-binding protein, negatively regulates the androgen receptor by recruiting histone deacetylase complex, and DJ-1 antagonizes this inhibition by abrogation of this complex. Mol. Cancer Res. (United States). 1 (4): 247-61.
  • Kahle PJ, et al. (2009) DJ-1 and prevention of oxidative stress in Parkinson's disease and other age-related disorders. Free Radic Biol Med. 47(10): 1354-61.
  • Xu X, et al. (2010) The familial Parkinson's disease gene DJ-1 (PARK7) is expressed in red cells and plays a role in protection against oxidative damage. Blood Cells Mol Dis. 45(3): 227-32.
  • Marcondes AM, et al. (2010) Identification of DJ-1/PARK-7 as a determinant of stroma-dependent and TNF-alpha-induced apoptosis in MDS using mass spectrometry and phosphopeptide analysis. Blood. 115(10): 1993-2002.
  • Size / Price
    Каталог: RG80500-NY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.