Быстрый заказ

Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Крыса OSTC Информация о продукте «Клон cDNA»
Размер кДНК:450bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus oligosaccharyltransferase complex subunit (non-catalytic) with N terminal Myc tag.
Синоним гена:Dc2,RGD1560708
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
( We provide with OSTC qPCR primers for gene expression analysis, RP300681 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80717-ACGRBS15400
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80717-ACRRBS15400
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80717-CFRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80717-CHRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80717-CMRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80717-CYRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80717-NFRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80717-NHRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80717-NMRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80717-NYRBS13340
Крыса OSTC/oligosaccharyltransferase complex subunit Джин клон кДНК в вектор клонированияRG80717-URBS5130
Крыса OSTC/oligosaccharyltransferase complex subunit Джин ORF экспрессии кДНК клона плазмидыRG80717-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80717-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.