Быстрый заказ

Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat OLR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_133306.1
Размер кДНК:1095bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus oxidized low density lipoprotein (lectin-like) receptor 1 with C terminal His tag.
Синоним гена:LOX-1, Oldr1, Oldlr1, Olr1
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80268-ACGRBS15400
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80268-ACRRBS15400
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80268-CFRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80268-CHRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80268-CMRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80268-CYRBS13340
Крыса OLR1/LOX1 Джин клон кДНК в вектор клонированияRG80268-GRBS5130
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80268-NFRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80268-NHRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80268-NMRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80268-NYRBS13340
Крыса OLR1/LOX1 Джин ORF экспрессии кДНК клона плазмидыRG80268-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

Ссылки
  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
  • Size / Price
    Каталог: RG80268-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».