After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NUDT5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001007733.1
Размер кДНК:660bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Myc tag.
Синоним гена:Nudt5
Виды:Rat
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81109-ACGRBS15396
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81109-ACRRBS15396
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81109-ANGRBS15396
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81109-ANRRBS15396
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81109-CFRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81109-CHRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81109-CMRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81109-CYRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81109-NFRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81109-NHRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81109-NMRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81109-NYRBS13343
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин клон кДНК в вектор клонированияRG81109-URBS5132
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмидыRG81109-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Ссылки
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Каталог: RG81109-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».