Быстрый заказ

Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NUDT5 Информация о продукте «Клон cDNA»
Размер кДНК:660bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.
Синоним гена:Nudt5
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81109-ACGRBS15400
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81109-ACRRBS15400
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81109-ANGRBS15400
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81109-ANRRBS15400
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81109-CFRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81109-CHRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81109-CMRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81109-CYRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81109-NFRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81109-NHRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81109-NMRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81109-NYRBS13340
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин клон кДНК в вектор клонированияRG81109-URBS5130
Крыса ADP-sugar Pyrophosphatase/NUDT5 Джин ORF экспрессии кДНК клона плазмидыRG81109-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Каталог: RG81109-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.