After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NTRK2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001163168.1
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus neurotrophic tyrosine kinase, receptor, type 2.
Синоним гена:Tkrb, trkB, TRKB1, RATTRKB1, Ntrk2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:pCMV3-ratNTRK2
Участок рестрикции:KpnI + XbaI (6.1kb + 1.43kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutation 816 T/C and 1302 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80243-ACGRBS15396
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80243-ACRRBS15396
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80243-CFRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80243-CHRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80243-CMRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80243-CYRBS13343
Крыса TrkB/NTRK2 Джин клон кДНК в вектор клонированияRG80243-GRBS5132
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80243-G-FRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80243-NFRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80243-NHRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80243-NMRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80243-NYRBS13343
Крыса TrkB/NTRK2 Джин ORF экспрессии кДНК клона плазмидыRG80243-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

TrkB receptor also known as TrkB tyrosine kinase or BDNF/NT-3 growth factors receptor or neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) is a single transmembrane catalytic receptors with intracellular tyrosine kinase activity. TrkB/NTRK2 is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. TrkB tyrosine kinase (TrkB) or NTRK2 is coupled to the Ras, Cdc42/Rac/RhoG, MAPK, PI3-K and PLCgamma signaling pathways. There are four members of the Trk family; TrkA, TrkB and TrkC and a related p75NTR receptor. Each family member binds different neurotrophins with varying affinities. TrkB/NTRK has highest affinity for brain-derived neurotrophic factor (BDNF) and is involved in neuronal plasticity, longterm potentiation and apoptosis of CNS neurons. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. TrkB/NTRK is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in TrkB/NTRK have been associated with obesity and mood disorders.

Ссылки
  • Klein R, et al. (1990) The trkB tyrosine protein kinase gene codes for a second neurogenic receptor that lacks the catalytic kinase domain. Cell. 61 (4): 647-56.
  • Rose CR, et al. (2003) Truncated TrkB-T1 mediates neurotrophin-evoked calcium signalling in glia cells. Nature. 426 (6962): 74-8.
  • Yamada K, et al. (2004) Brain-derived neurotrophic factor/TrkB signaling in memory processes. J Pharmacol Sci. 91 (4): 267-70.
  • Size / Price
    Каталог: RG80243-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».