Быстрый заказ

Text Size:AAA

Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NT5E Информация о продукте «Клон cDNA»
Размер кДНК:1731bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus 5' nucleotidase, ecto with N terminal His tag.
Синоним гена:Nt5, CD73, MGC112615, Nt5e
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80335-ACGRBS16760
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80335-ACRRBS16760
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80335-CFRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80335-CHRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80335-CMRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80335-CYRBS14710
Крыса CD73/NT5E Джин клон кДНК в вектор клонированияRG80335-GRBS5130
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80335-NFRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80335-NHRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80335-NMRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80335-NYRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмидыRG80335-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Каталог: RG80335-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.