Быстрый заказ

Text Size:AAA

Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NT5E Информация о продукте «Клон cDNA»
Размер кДНК:1731bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus 5' nucleotidase, ecto with C terminal HA tag.
Синоним гена:Nt5, CD73, MGC112615, Nt5e
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80335-ACGRBS16760
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80335-ACRRBS16760
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80335-CFRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80335-CHRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80335-CMRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80335-CYRBS14710
Крыса CD73/NT5E Джин клон кДНК в вектор клонированияRG80335-GRBS5130
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80335-NFRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80335-NHRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80335-NMRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80335-NYRBS14710
Крыса CD73/NT5E Джин ORF экспрессии кДНК клона плазмидыRG80335-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Каталог: RG80335-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.