After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NR1H3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_031627.2
Размер кДНК:1338bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nuclear receptor subfamily 1, group H, member 3.
Синоним гена:LXRalpha
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81002-ACGRBS15400
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81002-ACRRBS15400
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81002-ANGRBS15400
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81002-ANRRBS15400
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81002-CFRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81002-CHRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81002-CMRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81002-CYRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81002-NFRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81002-NHRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81002-NMRBS13340
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81002-NYRBS13340
Крыса NR1H3/LXR alpha Джин клон кДНК в вектор клонированияRG81002-URBS5130
Крыса NR1H3/LXR alpha Джин ORF экспрессии кДНК клона плазмидыRG81002-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81002-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».