After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NPHS1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_022628.1
Размер кДНК:3759bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nephrosis 1, congenital, Finnish type.
Синоним гена:Nphs1, nephrin
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80247-ACGRBS25660
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80247-ACRRBS25660
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80247-CFRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80247-CHRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80247-CMRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80247-CYRBS23610
Крыса Nephrin Джин клон кДНК в вектор клонированияRG80247-GRBS5130
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80247-NFRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80247-NHRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80247-NMRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80247-NYRBS23610
Крыса Nephrin Джин ORF экспрессии кДНК клона плазмидыRG80247-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80247-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».