Быстрый заказ

Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса NPHS1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_022628.1
    Размер кДНК:3759bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus nephrosis 1, congenital, Finnish type.
    Синоним гена:Nphs1, nephrin
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with NPHS1 qPCR primers for gene expression analysis, RP300232 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80247-ACGRBS25660
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80247-ACRRBS25660
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80247-CFRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80247-CHRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80247-CMRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80247-CYRBS23610
    Крыса Nephrin Джин клон кДНК в вектор клонированияRG80247-GRBS5130
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80247-NFRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80247-NHRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80247-NMRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80247-NYRBS23610
    Крыса Nephrin Джин ORF экспрессии кДНК клона плазмидыRG80247-UTRBS23610
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG80247-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».