Быстрый заказ

Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NPC2 Информация о продукте «Клон cDNA»
Размер кДНК:459bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus Niemann-Pick disease, type C2 with N terminal Myc tag.
Синоним гена:re1
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80706-ACGRBS15400
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80706-ACRRBS15400
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80706-CFRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80706-CHRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80706-CMRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80706-CYRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80706-NFRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80706-NHRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80706-NMRBS13340
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80706-NYRBS13340
Крыса NPC2 Джин клон кДНК в вектор клонированияRG80706-URBS5130
Крыса NPC2 Джин ORF экспрессии кДНК клона плазмидыRG80706-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.