After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NOSTRIN Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001024260.1
Размер кДНК:1509bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nitric oxide synthase trafficking.
Синоним гена:Nostrin
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80997-ACGRBS16760
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80997-ACRRBS16760
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80997-CFRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80997-CHRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80997-CMRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80997-CYRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80997-NFRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80997-NHRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80997-NMRBS14710
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80997-NYRBS14710
Крыса NOSTRIN Джин клон кДНК в вектор клонированияRG80997-URBS5130
Крыса NOSTRIN Джин ORF экспрессии кДНК клона плазмидыRG80997-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80997-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».