Быстрый заказ

Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса NONO Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001012356.1
    Размер кДНК:1431bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus non-POU domain containing, octamer-binding with N terminal His tag.
    Синоним гена:Nono
    Виды:Rat
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81632-ACGRBS15400
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81632-ACRRBS15400
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81632-ANGRBS15400
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81632-ANRRBS15400
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81632-CFRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81632-CHRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81632-CMRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81632-CYRBS13340
    Крыса NONO/p54nrb Джин клон кДНК в вектор клонированияRG81632-GRBS5130
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81632-NFRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81632-NHRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81632-NMRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81632-NYRBS13340
    Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмидыRG81632-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81632-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».