After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NONO Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001012356.1
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus non-POU domain containing, octamer-binding with N terminal His tag.
Синоним гена:Nono
Виды:Rat
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81632-ACGRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81632-ACRRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81632-ANGRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81632-ANRRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81632-CFRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81632-CHRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81632-CMRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81632-CYRBS13340
Крыса NONO/p54nrb Джин клон кДНК в вектор клонированияRG81632-GRBS5130
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81632-NFRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81632-NHRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81632-NMRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81632-NYRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмидыRG81632-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81632-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».