Быстрый заказ

Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NONO Информация о продукте «Клон cDNA»
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus non-POU domain containing, octamer-binding with N terminal His tag.
Синоним гена:Nono
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81632-ACGRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81632-ACRRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81632-ANGRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81632-ANRRBS15400
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81632-CFRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81632-CHRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81632-CMRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81632-CYRBS13340
Крыса NONO/p54nrb Джин клон кДНК в вектор клонированияRG81632-GRBS5130
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81632-NFRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81632-NHRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81632-NMRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81632-NYRBS13340
Крыса NONO/p54nrb Джин ORF экспрессии кДНК клона плазмидыRG81632-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81632-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.