Быстрый заказ

Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NINJ2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021595.1
Размер кДНК:435bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus ninjurin 2.
Синоним гена:Ninj2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80237-ACGRBS15400
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80237-ACRRBS15400
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80237-CFRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80237-CHRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80237-CMRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80237-CYRBS13340
Крыса Ninjurin2 Джин клон кДНК в вектор клонированияRG80237-GRBS5130
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80237-NFRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80237-NHRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80237-NMRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80237-NYRBS13340
Крыса Ninjurin2 Джин ORF экспрессии кДНК клона плазмидыRG80237-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80237-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».