Быстрый заказ

Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NCR1 Информация о продукте «Клон cDNA»
Размер кДНК:978bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus natural cytotoxicity triggering receptor 1 with C terminal HA tag.
Синоним гена:Ly94, Nkp46, KILR-1, Nk-p46, Ncr1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80378-ACGRBS15400
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80378-ACRRBS15400
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80378-CFRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80378-CHRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80378-CMRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80378-CYRBS13340
Крыса NCR1 / NK-p46 Джин клон кДНК в вектор клонированияRG80378-GRBS5130
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80378-NFRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80378-NHRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80378-NMRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80378-NYRBS13340
Крыса NCR1 / NK-p46 Джин ORF экспрессии кДНК клона плазмидыRG80378-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

NCR1, also known as NK-p46 and CD335, is a natural cytotoxicity receptor(NCR). NCRs are type I transmembrane proteins with 1-2 extracellular immunoglobulin domains, a transmembrane domain containing a positively charged amino acid residue, and a short cytoplasmic tail. All are expressed almost exclusively by NK cells and play a major role in triggering NK-mediated killing of most tumor cell lines. NKp46 has two extracellular Ig-like domains followed by a ~40 residue stalk region, a type I transmembrane domain, and a short cytoplasmic tail. NKp46 has been implicated in NK cell-mediated lysis of several autologous tumor cells, pathogen-infected cell lines and mononuclear phagocytes infected with an intracellular bacterium.

  • Carbone E, et al. (2005) HLA class I, NKG2D, and natural cytotoxicity receptors regulate multiple myeloma cell recognition by natural killer cells. Blood. 105(1):251-8.
  • Sivori S, et al. (1997) p46, a Novel Natural Killer Cell-specific Surface Molecule That Mediates Cell Activation. J Exp Med. 186(7):1129-36.
  • Biassoni R, et al. (2004) Human natural killer cell receptors: insights into their molecular function and structure. J Cell Mol Med. 7(4):376-87.
  • Size / Price
    Каталог: RG80378-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.