After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NCAPH2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001024877.1
Размер кДНК:1665bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus non-SMC condensin II complex, subunit H2.
Синоним гена:Ncaph2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81056-ACGRBS16760
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81056-ACRRBS16760
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81056-ANGRBS16760
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81056-ANRRBS16760
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81056-CFRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81056-CHRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81056-CMRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81056-CYRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81056-NFRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81056-NHRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81056-NMRBS14710
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81056-NYRBS14710
Крыса NCAPH2 Джин клон кДНК в вектор клонированияRG81056-URBS5130
Крыса NCAPH2 Джин ORF экспрессии кДНК клона плазмидыRG81056-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81056-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».