After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat NARFL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001013183.1
Размер кДНК:1431bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus nuclear prelamin A recognition factor-like with C terminal His tag.
Синоним гена:Narfl
Виды:Rat
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81036-ACGRBS15396
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81036-ACRRBS15396
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81036-ANGRBS15396
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81036-ANRRBS15396
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81036-CFRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81036-CHRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81036-CMRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81036-CYRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81036-NFRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81036-NHRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81036-NMRBS13343
Крыса NARFL Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81036-NYRBS13343
Крыса NARFL Джин клон кДНК в вектор клонированияRG81036-URBS5132
Крыса NARFL Джин ORF экспрессии кДНК клона плазмидыRG81036-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG81036-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».