Быстрый заказ

Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MYOT Информация о продукте «Клон cDNA»
Размер кДНК:1491bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus myotilin with C terminal His tag.
Синоним гена:Ttid
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81047-ACGRBS15400
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81047-ACRRBS15400
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81047-ANGRBS15400
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81047-ANRRBS15400
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81047-CFRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81047-CHRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81047-CMRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81047-CYRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81047-NFRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81047-NHRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81047-NMRBS13340
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81047-NYRBS13340
Крыса MYOT/Myotilin Джин клон кДНК в вектор клонированияRG81047-URBS5130
Крыса MYOT/Myotilin Джин ORF экспрессии кДНК клона плазмидыRG81047-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.