Быстрый заказ

Text Size:AAA

Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MSR1 Информация о продукте «Клон cDNA»
Размер кДНК:1365bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus macrophage scavenger receptor 1 with C terminal HA tag.
Синоним гена:RGD1564316, Msr1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80363-ACGRBS15400
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80363-ACRRBS15400
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80363-CFRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80363-CHRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80363-CMRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80363-CYRBS13340
Крыса MSR1/CD204 Джин клон кДНК в вектор клонированияRG80363-GRBS5130
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80363-NFRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80363-NHRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80363-NMRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80363-NYRBS13340
Крыса MSR1/CD204 Джин ORF экспрессии кДНК клона плазмидыRG80363-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger receptor class A member 1, CD204, MSR1 and SCARA1, is a single-pass type I I membrane protein which contains one collagen-like domain and one SRCR domain. Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). MSR1 / SCARA1 is one of the membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL). MSR1 / SCARA1 is also involved in chronic inflammation which is a risk factor for prostate cancer. MSR1 1 gene was identified as a candidate susceptibility gene for hereditary prostate cancer and as a risk factor for sporadic prostate cancer.

  • Wang L. et al., 2003, Nat Genet. 35 (2): 128-9.
  • Chen Y.C. et al., 2008, Cancer Epidemiol Biomarkers Prev. 17 (4): 1001-3.
  • Shirato K. et al., 2009, Pflugers Arch. 459 (1): 93-103.
  • Sun J. et al., 2006, Prostate. 66 (7): 728-37.
  • Size / Price
    Каталог: RG80363-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.