MRPL45 cDNA ORF Clone, Rat, untagged

Cat: RG80579-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All MRPL45 Reagents

CRO Services

Product recommended


All MRPL45 Reagents

MRPL45 cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
921 bp
Description
Full length Clone DNA of Rat mitochondrial ribosomal protein L45.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MRPL45 Background Information

Full Name
mitochondrial ribosomal protein L45

MRPL45 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MRPL45 cDNA ORF Clone in Cloning Vector, Rat RG80579-U
MRPL45 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80579-ACG
MRPL45 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80579-ACGLN
MRPL45 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80579-ANG
MRPL45 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80579-ACR
MRPL45 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80579-ANR
MRPL45 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80579-CF
MRPL45 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80579-NF
MRPL45 cDNA ORF Clone, Rat, C-His tag RG80579-CH
MRPL45 cDNA ORF Clone, Rat, N-His tag RG80579-NH
MRPL45 cDNA ORF Clone, Rat, C-HA tag RG80579-CY
MRPL45 cDNA ORF Clone, Rat, N-HA tag RG80579-NY
MRPL45 cDNA ORF Clone, Rat, C-Myc tag RG80579-CM
MRPL45 cDNA ORF Clone, Rat, N-Myc tag RG80579-NM
MRPL45 qPCR Primer Pairs, Rat RP300543

MRPL45 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MRPL45 cDNA ORF Clone in Cloning Vector, Mouse MG5A5514-U
MRPL45 cDNA ORF Clone, Mouse, untagged MG5A5514-UT
MRPL45 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5514-ACGLN
MRPL45 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5514-ACG
MRPL45 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5514-ANG
MRPL45 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5514-ACR
MRPL45 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5514-ANR
MRPL45 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5514-CF
MRPL45 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5514-NF
MRPL45 cDNA ORF Clone, Mouse, C-His tag MG5A5514-CH
MRPL45 cDNA ORF Clone, Mouse, N-His tag MG5A5514-NH
MRPL45 cDNA ORF Clone, Mouse, C-HA tag MG5A5514-CY
MRPL45 cDNA ORF Clone, Mouse, N-HA tag MG5A5514-NY
MRPL45 cDNA ORF Clone, Mouse, C-Myc tag MG5A5514-CM
MRPL45 cDNA ORF Clone, Mouse, N-Myc tag MG5A5514-NM

MRPL45 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MRPL45 cDNA ORF Clone in Cloning Vector, Human HG16148-G
MRPL45 cDNA ORF Clone, Human, untagged HG16148-UT
MRPL45 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16148-ACGLN
MRPL45 cDNA ORF Clone, Human, C-GFPSpark® tag HG16148-ACG
MRPL45 cDNA ORF Clone, Human, N-GFPSpark® tag HG16148-ANG
MRPL45 cDNA ORF Clone, Human, C-OFPSpark® tag HG16148-ACR
MRPL45 cDNA ORF Clone, Human, N-OFPSpark® tag HG16148-ANR
MRPL45 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16148-CF
MRPL45 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16148-NF
MRPL45 cDNA ORF Clone, Human, C-His tag HG16148-CH
MRPL45 cDNA ORF Clone, Human, N-His tag HG16148-NH
MRPL45 cDNA ORF Clone, Human, C-HA tag HG16148-CY
MRPL45 cDNA ORF Clone, Human, N-HA tag HG16148-NY
MRPL45 cDNA ORF Clone, Human, C-Myc tag HG16148-CM
MRPL45 cDNA ORF Clone, Human, N-Myc tag HG16148-NM
MRPL45 qPCR Primer Pairs, Human HP104917
info info
添加购物车成功! 添加购物车失败!