Быстрый заказ

Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MPL Информация о продукте «Клон cDNA»
Размер кДНК:1935bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus myeloproliferative leukemia virus oncogene with C terminal HA tag.
Синоним гена:Mpl
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80346-ACGRBS16760
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80346-ACRRBS16760
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80346-CFRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80346-CHRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80346-CMRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80346-CYRBS14710
Крыса c-MPL / CD110 / TPOR Джин клон кДНК в вектор клонированияRG80346-GRBS5130
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80346-NFRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80346-NHRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80346-NMRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80346-NYRBS14710
Крыса c-MPL / CD110 / TPOR Джин ORF экспрессии кДНК клона плазмидыRG80346-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
Каталог: RG80346-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.