Быстрый заказ

Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Крыса MORF4L1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_001011999.1
    Размер кДНК:972bp
    Описание кДНК:Full length Clone DNA of Rattus norvegicus mortality factor 4 like 1.
    Синоним гена:Morf4l1
    Виды:Rat
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MORF4L1 qPCR primers for gene expression analysis, RP300994 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG81030-ACGRBS15400
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG81030-ACRRBS15400
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаRG81030-ANGRBS15400
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаRG81030-ANRRBS15400
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG81030-CFRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG81030-CHRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG81030-CMRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG81030-CYRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG81030-NFRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG81030-NHRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG81030-NMRBS13340
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG81030-NYRBS13340
    Крыса MORF4L1 Джин клон кДНК в вектор клонированияRG81030-URBS5130
    Крыса MORF4L1 Джин ORF экспрессии кДНК клона плазмидыRG81030-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: RG81030-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».