After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Rat MMRN2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:
Размер кДНК:1617bp
Описание кДНК:Full length Clone DNA of Rattus norvegicus multimerin 2.
Синоним гена:Mmrn2
Виды:Rat
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаRG80257-ACGRBS16760
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаRG80257-ACRRBS16760
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаRG80257-CFRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаRG80257-CHRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаRG80257-CMRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаRG80257-CYRBS14710
Крыса MMRN2 Джин клон кДНК в вектор клонированияRG80257-GRBS5130
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаRG80257-NFRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаRG80257-NHRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаRG80257-NMRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаRG80257-NYRBS14710
Крыса MMRN2 Джин ORF экспрессии кДНК клона плазмидыRG80257-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: RG80257-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».